Ribosoma

Enviado por Programa Chuletas y clasificado en Biología

Escrito el en español con un tamaño de 4,55 KB

 
Ribosoma
De Wikipedia, la enciclopedia libre
Saltar a navegación, búsqueda
Los
ribosomas son orgánulos sin membrana, sólo visibles al microscopio electrónico debido a su reducido tamaño ( 29 nm en célula procariota y 32 nm en eucariota). Están en todas las células vivas (excepto en el espermatozoide). Su función es ensamblar proteínas a partir de la información genética que le llega del ADN transcrita en forma de ARN mensajero (ARNm).
La información genética está en el
ADN. Esa información se transcribe en ARN.
El ribosoma lee el
ARN mensajero y ensambla la proteína con los aminoácidos suministrados por el ARN de transferencia.
La
proteína es una cadena formada por aminoácidos. Entre los seres vivos se han descubierto hasta ahora 22 aminoácidos. Y así hasta que llega un codón que indica que la proteína se acabó: es el codón de terminación. El ribosoma consta de dos partes, la subunidad mayor y una menor, estas salen del núcleo por separado. Por experimentación se puede decir que se mantienen unidasa por cargas, en una prueba se bajó la concentración de Mg+2, cuando se bajaban las concentraciones las subunidades tendían a separarse. El ribosoma procariota tiene un coeficiente de sedimentación de 70s y está formado por dos subunidades (50s y 30s. El ribosoma eucariota tiene un coeficiente de sedimentación de 80s (formado por dos subunidades, una de 60s y otra de 40s). Este se puede encontrar unido al RER (forma habitual en la célula eucariota) o encontrarlo en el citoplasma, cuando se encuentra en el citoplasma se llama polisoma o polirribosoma (forma habitual en la célula procariota). Este polisoma se encarga de sintetizar proteínas que serán ocupadas por la célula, mientras que el ribosoma se encarga de sintetizar proteínas de exportación, o sea que se irán de la célula hacia otro lugar donde se necesite.
Por ejemplo:
El ARN es éste:
AUGGCCAACGGCAUGCCUACUUAA
AUG le indica que tiene que empezar a ensamblar la proteína; es un codón de iniciación.
GCC es
Alanina. Coge alanina (un aminoácido) y lo sujeta.
AAC es
Arginina, lo une con la alanina.
GGC es
Glicina, lo ensambla a la arginina.
AUG era el símbolo de iniciación, pero ya ha comenzado; así que lo interpreta como
Metionina. Une el aminoácido metionina con la glicina anterior.
CCU es
Prolina. Ensambla la prolina a la metionina.
ACU es
Serina. Ensambla la serina con la prolina.
UAA es
terminación. Deja de ensamblar la proteína.
Por tanto, la proteína ensamblada ha sido: Alanina-Arginina-Glicina-Metionina-Prolina-Serina

Figura 3 : Traducción (1) de ARNm por un ribosoma (2) en una cadena polipeptídica (3). El ARNm comienza con un codón de iniciación (AUG) y finaliza con un codon de terminación (UAG).